XB-FEAT-855943: Difference between revisions
| Line 14: | Line 14: | ||
08.26.19 | 08.26.19 | ||
As Xenopus follows human nomenclature, XB kept the 'like' designation, so new name is H2A.X variant histone-like, and new symbol for ''Xenopus'' gene is ''h2axl''. | As Xenopus follows human nomenclature, XB kept the 'like' designation, so new name is H2A.X variant histone-like, and new symbol for ''Xenopus'' gene is ''h2axl''. | ||
17JULY2022 | |||
Human-Like symbol has changed for genepage ID: 855943 From h2axl to H2AX ( the like is gone!) Xenopus gene changed from h2axl to h2ax Note: this page had a few typos with dots (.) in in gene symbols. These have been removed. | |||
=Available Reagents= | =Available Reagents= | ||
Revision as of 13:55, 28 July 2022
h2axl
This is the community wiki page for the gene h2axl please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
nomenclature changes
On 7/3/2019, this gene was changed from h2afx to h2afxl to designate that it is a like gene.
08.23.2019
Human symbol has changed for gene page ID: 855943 From h2afxl to h2aX
Human symbol has changed for Entrez Gene: 3014. From H2AFX to H2AX
Human name has changed for Entrez Gene: 3014. From H2A histone family member X to H2A.X variant histone
08.26.19
As Xenopus follows human nomenclature, XB kept the 'like' designation, so new name is H2A.X variant histone-like, and new symbol for Xenopus gene is h2axl.
17JULY2022
Human-Like symbol has changed for genepage ID: 855943 From h2axl to H2AX ( the like is gone!) Xenopus gene changed from h2axl to h2ax Note: this page had a few typos with dots (.) in in gene symbols. These have been removed.
Available Reagents
Morpholino Oligonucleotides
Morpholinos have been designed for this gene with sequences
TGACGGCTTTTCCTCTGCCCGACAT
which were used in [1]
This sequence is shared by gene hist2h2ab and may, therefore, be cross-reactive.