XB-FEAT-855943: Difference between revisions

From XenWiki
Jump to navigation Jump to search
Line 4: Line 4:
=nomenclature changes=
=nomenclature changes=
On 7/3/2019, this gene was changed from ''h2afx'' to ''h2afxl'' to designate that it is a like gene.
On 7/3/2019, this gene was changed from ''h2afx'' to ''h2afxl'' to designate that it is a like gene.
 
As Xenopus follows human nomenclature, XB kept the 'like' designation,  so new name is H2A.X variant histone-like, and new symbol for ''Xenopus'' gene is ''h2axl''.
08.23.2019
08.23.2019


Line 13: Line 13:
Human name has changed for Entrez Gene: 3014. From H2A histone family member X to H2A.X variant histone
Human name has changed for Entrez Gene: 3014. From H2A histone family member X to H2A.X variant histone


08.26.19
17JULY2022
 
Human-Like symbol has changed for genepage ID: 855943 From h2axl to H2AX ( the like is gone!)


As Xenopus follows human nomenclature, XB kept the 'like' designation,  so new name is H2A.X variant histone-like, and new symbol for ''Xenopus'' gene is ''h2axl''.
''Xenopus'' gene changed from ''h2axl'' back to ''h2ax''


17JULY2022
Note: this page had a few typos with dots (.) in in gene symbols. These have been removed.


Human-Like symbol has changed for genepage ID: 855943 From h2axl to H2AX ( the like is gone!) Xenopus gene changed from h2axl to h2ax Note: this page had a few typos with dots (.) in in gene symbols. These have been removed.
a synteny/phylogenetic anaylsis might be needed to see if this Xenopus gene is the true ortholog of the human H2AX


=Available Reagents=
=Available Reagents=

Revision as of 14:58, 28 July 2022

h2axl

This is the community wiki page for the gene h2axl please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

nomenclature changes

On 7/3/2019, this gene was changed from h2afx to h2afxl to designate that it is a like gene. As Xenopus follows human nomenclature, XB kept the 'like' designation, so new name is H2A.X variant histone-like, and new symbol for Xenopus gene is h2axl. 08.23.2019

Human symbol has changed for gene page ID: 855943 From h2afxl to h2aX

Human symbol has changed for Entrez Gene: 3014. From H2AFX to H2AX

Human name has changed for Entrez Gene: 3014. From H2A histone family member X to H2A.X variant histone

17JULY2022

Human-Like symbol has changed for genepage ID: 855943 From h2axl to H2AX ( the like is gone!)

Xenopus gene changed from h2axl back to h2ax

Note: this page had a few typos with dots (.) in in gene symbols. These have been removed.

a synteny/phylogenetic anaylsis might be needed to see if this Xenopus gene is the true ortholog of the human H2AX

Available Reagents

Morpholino Oligonucleotides

Morpholinos have been designed for this gene with sequences
TGACGGCTTTTCCTCTGCCCGACAT

which were used in [1]

This sequence is shared by gene hist2h2ab and may, therefore, be cross-reactive.