XB-FEAT-920500: Difference between revisions
Jump to navigation
Jump to search
| Line 6: | Line 6: | ||
1MAY2023 | 1MAY2023 | ||
Xenopus gene symbol was changed from ''ventx1.1'' to ''ventx1'' | ''Xenopus'' gene symbol was changed from ''ventx1.1'' to ''ventx1'' | ||
Latest revision as of 09:44, 1 May 2023
ventx1
This is the community wiki page for the gene ventx1 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase.
nomenclature changes
1MAY2023
Xenopus gene symbol was changed from ventx1.1 to ventx1
Available Reagents
Morpholino Oligonucleotides
Morpholinos have been designed for this gene with sequences
CAATAGAGAATCCCTGTTGAACCAT
This morpholino is 100% conserved against the homeolog ventx1.2
which were used in [1]