XB-FEAT-855943: Difference between revisions
Line 1: | Line 1: | ||
= h2axl = | = ''h2axl'' = | ||
This is the community wiki page for the gene ''h2axl'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase | This is the community wiki page for the gene ''h2axl'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase | ||
Revision as of 08:04, 25 February 2025
h2axl
This is the community wiki page for the gene h2axl please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
nomenclature changes
On 7/3/2019, this gene was changed from h2afx to h2afxl to designate that it is a like gene. As Xenopus follows human nomenclature, XB kept the 'like' designation, so new name is H2A.X variant histone-like, and new symbol for Xenopus gene is h2axl.
Although it has ping-ponged back and forth (the 2019 amnd 2022 changes reversed here), DO NOT CHANGE back to h2afx, as these are the NOT true orthologs of human H2AFX.- CJZ
Available Reagents
Morpholino Oligonucleotides
Morpholinos have been designed for this gene with sequences
TGACGGCTTTTCCTCTGCCCGACAT
which were used in [1]
This sequence is shared by gene hist2h2ab and may, therefore, be cross-reactive.