XB-FEAT-855943: Difference between revisions

From XenWiki
Jump to navigation Jump to search
 
Line 7: Line 7:


Although it has ping-ponged back and forth (the 2019 amnd 2022 changes reversed here), '''DO NOT CHANGE''' back to ''h2afx'', as these are the NOT true orthologs of human H2AFX.- CJZ
Although it has ping-ponged back and forth (the 2019 amnd 2022 changes reversed here), '''DO NOT CHANGE''' back to ''h2afx'', as these are the NOT true orthologs of human H2AFX.- CJZ
=Available Reagents=
==Morpholino Oligonucleotides==
Morpholinos have been designed for this gene with sequences <br />
TGACGGCTTTTCCTCTGCCCGACAT <br />
which were used in [http://www.xenbase.org/literature/article.do?method=display&articleId=41767]
This sequence is shared by gene ''hist2h2ab'' and may, therefore, be cross-reactive.

Latest revision as of 14:11, 25 February 2025

h2axl

This is the community wiki page for the gene h2axl please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

nomenclature changes

On 7/3/2019, this gene was changed from h2afx to h2afxl to designate that it is a like gene. As Xenopus follows human nomenclature, XB kept the 'like' designation, so new name is H2A.X variant histone-like, and new symbol for Xenopus gene is h2axl.

Although it has ping-ponged back and forth (the 2019 amnd 2022 changes reversed here), DO NOT CHANGE back to h2afx, as these are the NOT true orthologs of human H2AFX.- CJZ