XB-FEAT-484685

From XenWiki

Revision as of 08:33, 12 November 2012 by imported>Kevin (→‎smad9)

(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)

Jump to navigation Jump to search

smad9

This is the community wiki page for the gene smad9 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

A morpholino has been designed for this gene with sequence TGCATTGGATTTGCTGTGTTTACC which was used in [1]

Retrieved from "https://wiki.xenbase.org/xenwiki/index.php?title=XB-FEAT-484685&oldid=21899"