XB-FEAT-854157

From XenWiki
Revision as of 15:22, 22 May 2017 by imported>Xenbase
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

wnt11

This is the community wiki page for the gene wnt11 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

Available Reagents

Morpholino Oligonucleotides

Morpholinos have been designed for this gene with sequences

CTTCATCTTCAAAACCCAATAACAA

which was used in [1],[2],[3]

and

ACTGTATCCAAAGAGAGTTCCGAGG

which was used in [4]

nomenclature changes

04/22/ 2016

Human name has changed for Entrez Gene: 7481. From wingless-type MMTV integration site family member 11 to Wnt family member 11