XB-FEAT-919663

From XenWiki
Revision as of 09:39, 13 November 2012 by imported>Kevin
Jump to navigation Jump to search

ventx2.1

This is the community wiki page for the gene ventx2.1 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

Available Reagents

Morpholino Oligonucleotides

Morpholinos have been designed for this gene with sequences
TTCCTGTAGTAGTCCTTGTGTTCAT


which were used in [1]

Retrieved from "https://wiki.xenbase.org/xenwiki/index.php?title=XB-FEAT-919663&oldid=27825"