XB-MORPHOLINO-17251707

From XenWiki
Revision as of 06:34, 25 February 2015 by imported>Kevin
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

Note that the published sequence differs from the genomic sequence as provided by JGI. The published morpholino has an additional T relative to this genomic-based sequence: GCGTGCCTCGTCTGGG CGCCGCCATCTTACTTGTGGTCA CGTGCCTA

Retrieved from "https://wiki.xenbase.org/xenwiki/index.php?title=XB-MORPHOLINO-17251707&oldid=47472"