XB-FEAT-493412

From XenWiki
Revision as of 09:52, 19 November 2012 by imported>Kevin (→‎arfgap3)
Jump to navigation Jump to search

arfgap3

This is the community wiki page for the gene arfgap3 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

Available Reagents

Morpholino Oligonucleotides

Morpholinos have been designed for this gene with sequences
CGGTTCCGCCATTCTCCGTCTCTCT

which were used in [1]

Retrieved from "https://wiki.xenbase.org/xenwiki/index.php?title=XB-FEAT-493412&oldid=25219"