XB-FEAT-5955200

From XenWiki
Revision as of 11:18, 19 November 2012 by imported>Kevin
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

ctnna2

This is the community wiki page for the gene ctnna2 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

Available Reagents

Morpholino Oligonucleotides

Morpholinos have been designed for this gene with sequences
GGCAGAAGACATGTTCCTCTATTG

which were used in [1]