XB-FEAT-482276

From XenWiki
Revision as of 08:06, 18 November 2016 by imported>Christina (→‎cdh3)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

cdh3

This is the community wiki page for the gene cdh1 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase.

nomenclature changes

11/07/2016 Human name has changed for Entrez Gene: 1001. From cadherin 3, type 1, P-cadherin (placental) to cadherin 3


Available Reagents

Morpholino Oligonucleotides

Morpholinos have been designed for this gene with sequences
CCACCGTCCCGAACAGAAGCCTCAT

which were used in [1]