XB-FEAT-5719326

h2ac21

This is the community wiki page for the gene h2ac21 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

nomenclature changes

08.23.2019

Human name has changed for Entrez Gene: 317772. From histone cluster 2 H2A family member b to H2A clustered histone 21

Human symbol has changed for genepage ID: 5719326 From hist2h2ab to h2ac21

Human symbol has changed for Entrez Gene: 317772. From HIST2H2AB to H2AC21

Available Reagents

Morpholino Oligonucleotides

Morpholinos have been designed for this gene with sequences
TGACGGCTTTTCCTCTGCCCGACAT

which were used in [1]

This sequence is shared by gene symbol H2AFX and may therefore be cross-reactive.