XB-FEAT-479875

From XenWiki

Revision as of 11:27, 12 November 2012 by imported>Kevin

(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)

Jump to navigation Jump to search

pax5

This is the community wiki page for the gene pax5 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

Morpholinos have been designed for this gene with a sequence
GGTCGTGCTTACAGTGTATTTCCAT

which was used in [1]

Retrieved from "https://wiki.xenbase.org/xenwiki/index.php?title=XB-FEAT-479875&oldid=22533"