XB-FEAT-487123

From XenWiki
Revision as of 19:06, 26 February 2013 by imported>Kevin
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

xbp1

This is the community wiki page for the gene xbp1 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

Available Reagents

Morpholino Oligonucleotides

Morpholinos have been designed for this gene with sequences
GCTCCCACGACCACCATGTTGAAGG


which were used in [1]