XB-FEAT-855461

From XenWiki
Revision as of 11:36, 12 November 2012 by imported>Kevin
Jump to navigation Jump to search

tcf7

This is the community wiki page for the gene tcf7 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase


Morpholinos have been designed for this gene with a sequence
CGGCGCTGTTCATTTGGGGCAT


which was used in [1], [2], [3]