XB-FEAT-855943

From XenWiki
Revision as of 11:09, 19 November 2012 by imported>Kevin (→‎h2afx)
Jump to navigation Jump to search

h2afx

This is the community wiki page for the gene h2afx please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

Available Reagents

Morpholino Oligonucleotides

Morpholinos have been designed for this gene with sequences
TGACGGCTTTTCCTCTGCCCGACAT

which were used in [1]

This sequence is shared by gene symbol hist2h2ab and may therefore be cross-reactive.

Retrieved from "https://wiki.xenbase.org/xenwiki/index.php?title=XB-FEAT-855943&oldid=27346"