XB-FEAT-855943

From XenWiki
Revision as of 07:50, 26 August 2019 by imported>Xenbase (→‎Nomenclature)
Jump to navigation Jump to search

h2afxl

This is the community wiki page for the gene h2afxl please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

Nomenclature

nomenclature changes

On 7/3/2019, this gene was changed from h2afx to h2afxl to designate that it is a like gene.

08.23.2019

Human symbol has changed for genepage ID: 855943 From h2afxl to h2aX Human symbol has changed for Entrez Gene: 3014. From H2AFX to H2AX Human name has changed for Entrez Gene: 3014. From H2A histone family member X to H2A.X variant histone

08.26.19 As Xenopus follows human nomenlcature, XB kept the 'like' designation, so new name is H2A.X variant histone-like, and new symbol for Xenopus gene is h2axl

Available Reagents

Morpholino Oligonucleotides

Morpholinos have been designed for this gene with sequences
TGACGGCTTTTCCTCTGCCCGACAT

which were used in [1]

This sequence is shared by gene symbol hist2h2ab and may therefore be cross-reactive.