XB-FEAT-855943

From XenWiki
Revision as of 11:24, 23 October 2019 by imported>Xenbase (→‎nomenclature changes)
Jump to navigation Jump to search

h2axl

This is the community wiki page for the gene h2axl please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

nomenclature changes

On 7/3/2019, this gene was changed from h2afx to h2afxl to designate that it is a like gene.

08.23.2019

Human symbol has changed for gene page ID: 855943 From h2afxl to h2aX

Human symbol has changed for Entrez Gene: 3014. From H2AFX to H2AX

Human name has changed for Entrez Gene: 3014. From H2A histone family member X to H2A.X variant histone


08.26.19 As Xenopus follows human nomenclature, XB kept the 'like' designation, so new name is H2A.X variant histone-like, and new symbol for Xenopus gene is h2axl

Available Reagents

Morpholino Oligonucleotides

Morpholinos have been designed for this gene with sequences
TGACGGCTTTTCCTCTGCCCGACAT

which were used in [1]

This sequence is shared by gene symbol hist2h2ab and may, therefore, be cross-reactive.