XB-FEAT-922931

From XenWiki
Revision as of 08:44, 7 June 2017 by imported>Xenbase
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

ntrk2

This is the community wiki page for the gene ntrk2 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

Available Reagents

Morpholino Oligonucleotides

Morpholinos have been designed for this gene with sequences
CCACTGGATCCCCCCTAGAATGGAG

which were used in [1]

nomenclature changes

04/22/ 2016

Human name has changed for Entrez Gene: 4915. From neurotrophic tyrosine kinase, receptor, type 2 to neurotrophic receptor tyrosine kinase 2

Retrieved from "https://wiki.xenbase.org/xenwiki/index.php?title=XB-FEAT-922931&oldid=28441"