XB-FEAT-5995151
smad10
This is the community wiki page for the gene smad10 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
Available Reagents
Morpholino Oligonucleotides
Morpholinos have been designed for this gene with sequences
CGCCATCTTTTGCCCTTGTTGTTAC (5' UTR / translation blocking)
which were used in [1]
nomenclature changes
22FEB2023
following analysis by NCBI RefSeq curator, David Webb, this gene name has changed from smad4.2 to smad10, following nomenclature on fishes.
synteny for smad10 in vertebrates
SMAD10 Mammals S100A14< S100A13< S100A1> CHTOP> SNAPIN> ILF2< NPR1<
Gg GeneID: 107055136 XP_040508511.1 S100A14< S100A13< S100A1> CHTOP> "SMAD4"> SNAPIN> ILF2< npr1<
C.mydas GeneID:114021305 XP_037739145.1 S100A14< S100A13< S100A1> CHTOP> SMAD> SNAPIN> ILF2< NPR1<
Podarcis XP_028565796.1 S100A13< S100A1> CHTOP> smad> SNAPIN> ILF2< NPR1<
Xtr GeneID: 100188925 XP_031747717.1 XB-GENE-5995152 [Xla GeneID: 403356] S100A16< S100A13< S100A1> CHTOP> "SMAD4.2"> SNAPIN> ILF2< NPR1<
lungfish XP_043935901.1 s100a< s100a< s100a1> chtop> smad> SNAPIN> ILF2< NPR1<
reedfish GeneID: 114646771 XP_028650943.1 npr1< ilf2< CHTOPA< snapin> SMAD> gon4l> ca14<
Dr Gene ID: 560317 ZDB-GENE-060503-248 NP_001352568.1 PIMR92< MATCAP2< CHTOPA< SNAPIN> SMAD10A> SYT11A> RIT1> PEX11B>
Dr Gene ID: 100151181 ZDB-GENE-110408-38 XP_001922725.2 GPATCH4< GON4L< NPR1B< CHTOPB< SMAD10B> SYT11B> LOC> LOC< TRIM33L< DCST2<
Flounder MN868432 QOJ43528.1= XP_019960855.1 Gene ID: 109641002 GATAD2B> TXNIP< CHTOP< SNAPIN> SMAD10A> PEX11B> ILF2< ms4a#< sema4b< S100A14<
flounder MN868433.1 QOJ43529.1= XP_019963807.1 Gene ID: 109643214 //tspan19/cd82< SMAD10b>//
skate GeneID: 116968878 XP_032871745.1 GBA< chtop> SMAD> LOC> nitr12< TDRKH< sema7a< sema4b>