XB-FEAT-920500

From XenWiki
Revision as of 16:44, 1 May 2023 by Christina (talk | contribs) (nomenclature changes)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

ventx1

This is the community wiki page for the gene ventx1 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase.

nomenclature changes

1MAY2023

Xenopus gene symbol was changed from ventx1.1 to ventx1


Available Reagents

Morpholino Oligonucleotides

Morpholinos have been designed for this gene with sequences
CAATAGAGAATCCCTGTTGAACCAT

This morpholino is 100% conserved against the homeolog ventx1.2

which were used in [1]