XB-FEAT-493412

From XenWiki
Revision as of 18:45, 30 October 2024 by Xenbase (talk | contribs) (arfgap3)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

arfgap3

This is the community wiki page for the gene arfgap3 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase.

nomenclature changes

29OCT202

Human symbol has changed for Entrez Gene: 26286. From ARF GTPase activating protein 3 to arfgap3

Human name has changed for Entrez Gene: 26286. From ADP ribosylation factor GTPase activating protein 3 to ARF GTPase activating protein 3


Available Reagents

Morpholino Oligonucleotides

Morpholinos have been designed for this gene with sequences
CGGTTCCGCCATTCTCCGTCTCTCT

which were used in [1]