XB-FEAT-479598

From XenWiki
(Redirected from Alpha(E)-catenin)
Jump to navigation Jump to search

ctnna1

This is the community wiki page for the gene ctnna1 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

Available Reagents

Morpholino Oligonucleotides

Morpholinos have been designed for this gene with sequences
ATGTTTCCTGTATTGAGAGTCATGC

which were used in [1]

Retrieved from "https://wiki.xenbase.org/xenwiki/index.php?title=XB-FEAT-479598&oldid=22428"