XB-FEAT-997275

From XenWiki
(Redirected from C12orf11)
Jump to navigation Jump to search

asun

This is the community wiki page for the gene c12orf11 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

Available Reagents

Morpholino Oligonucleotides

Morpholinos have been designed for this gene with sequences
TCCGAGAAAGTCTTCATCTTGTCTG

which were used in [1]

Retrieved from "https://wiki.xenbase.org/xenwiki/index.php?title=XB-FEAT-997275&oldid=6974"