XB-FEAT-484970

From XenWiki
(Redirected from Cerberus)
Jump to navigation Jump to search

cer1

This is the community wiki page for the gene cer1 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

nomenclature changes

HGNC records the following previous names and synonyms for cer1: "cerberus 1 (Xenopus laevis) homolog (cysteine knot superfamily)", "cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis)"

available reagents

Morpholino Oligonucleotides

Morpholinos have been designed for this gene with sequences
CTAGACCCTGCAGTGTTTCTGAGCG

which were used in [1]