XB-FEAT-852873

From XenWiki
(Redirected from Dcc)
Jump to navigation Jump to search

dcc

This is the community wiki page for the gene dcc please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

Available Reagents

Morpholino Oligonucleotides

Morpholinos have been designed for this gene with sequences
CCAAGACAATTCTCCATATTTCAGC

which were used in [1]