XB-FEAT-482276
(Redirected from E-Cad)
cdh3
This is the community wiki page for the gene cdh1 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase.
nomenclature changes
11/07/2016 Human name has changed for Entrez Gene: 1001. From cadherin 3, type 1, P-cadherin (placental) to cadherin 3
Available Reagents
Morpholino Oligonucleotides
Morpholinos have been designed for this gene with sequences
CCACCGTCCCGAACAGAAGCCTCAT
which were used in [1]