XB-FEAT-976597

From XenWiki
(Redirected from Gad2)
Jump to navigation Jump to search

gad2

This is the community wiki page for the gene gad2 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

Available Reagents

Morpholino Oligonucleotides

Morpholinos have been designed for this gene with sequences
AAAACCCCGAGCCAGGAGACGCCAT

which were used in [1]