XB-FEAT-855943

From XenWiki
(Redirected from H2ax)
Jump to navigation Jump to search

h2axl

This is the community wiki page for the gene h2axl please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

nomenclature changes

On 7/3/2019, this gene was changed from h2afx to h2afxl to designate that it is a like gene. As Xenopus follows human nomenclature, XB kept the 'like' designation, so new name is H2A.X variant histone-like, and new symbol for Xenopus gene is h2axl. 08.23.2019

Human symbol has changed for gene page ID: 855943 From h2afxl to h2aX

Human symbol has changed for Entrez Gene: 3014. From H2AFX to H2AX

Human name has changed for Entrez Gene: 3014. From H2A histone family member X to H2A.X variant histone

17JULY2022

Human-Like symbol has changed for genepage ID: 855943 From h2axl to H2AX ( the like is gone!)

Xenopus gene changed from h2axl back to h2ax

Note: this page had a few typos with dots (.) in in gene symbols. These have been removed.

a synteny/phylogenetic anaylsis might be needed to see if this Xenopus gene is the true ortholog of the human H2AX

Available Reagents

Morpholino Oligonucleotides

Morpholinos have been designed for this gene with sequences
TGACGGCTTTTCCTCTGCCCGACAT

which were used in [1]

This sequence is shared by gene hist2h2ab and may, therefore, be cross-reactive.