XB-FEAT-5719326

From XenWiki
(Redirected from Hist2h2ab)
Jump to navigation Jump to search

h2ac21

This is the community wiki page for the gene h2ac21 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

nomenclature changes

08.23.2019

Human name has changed for Entrez Gene: 317772. From histone cluster 2 H2A family member b to H2A clustered histone 21

Human symbol has changed for genepage ID: 5719326 From hist2h2ab to h2ac21

Human symbol has changed for Entrez Gene: 317772. From HIST2H2AB to H2AC21

Summary for human from NCBI

Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2A family. Transcripts from this gene contain a palindromic termination element. [provided by RefSeq, Aug 2015]

Available Reagents

Morpholino Oligonucleotides

Morpholinos have been designed for this gene with sequences
TGACGGCTTTTCCTCTGCCCGACAT

which were used in [1]

This sequence is shared by gene symbol H2AFX and may therefore be cross-reactive.