XB-FEAT-976426

From XenWiki
(Redirected from K-glypican)
Jump to navigation Jump to search

gpc4

This is the community wiki page for the gene gpc4 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

Available Reagents

Morpholino Oligonucleotides

Morpholinos have been designed for this gene with sequences
TGCATGGTGAGAACGAAAGCGATC

which were used in [1]