XB-FEAT-483343

From XenWiki
(Redirected from Mgc52995)
Jump to navigation Jump to search

ruvbl2

This is the community wiki page for the gene ruvbl2 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase


Available Reagents

Morpholino Oligonucleotides

Morpholinos have been designed for this gene with sequences
GAAGATATAGTGCAGCATGGCAACC

which were used in [1]

Retrieved from "https://wiki.xenbase.org/xenwiki/index.php?title=XB-FEAT-483343&oldid=20729"