XB-FEAT-482076

From XenWiki
(Redirected from Szl)
Jump to navigation Jump to search

szl

This is the community wiki page for the gene szl please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

Available Reagents

Morpholino Oligonucleotides

Morpholinos have been designed for this gene with sequences
GAGGAGCAGGAAGACTCCGGTCATG


which were used in [1][2]