XB-FEAT-855461

From XenWiki
(Redirected from Tcf7)
Jump to navigation Jump to search

tcf7

This is the community wiki page for the gene tcf7 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

Morpholinos

the following Morpholino was designed for this gene with a sequence
CGGCGCTGTTCATTTGGGGCAT

This MO was used in [1], [2], [3]


nomenclature changes

05/15/2017 Human name has changed for Entrez Gene: 6932. From transcription factor 7 (T-cell specific, HMG-box) to transcription factor 7