XB-FEAT-920867
(Redirected from Vent-1)
ventx1.2
This is the community wiki page for the gene ventx1.2 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
Available Reagents
Morpholino Oligonucleotides
Morpholinos have been designed for this gene with sequences
CAATAGAGAATCCCTGTTGAACCAT
This morpholino is 100% conserved against the homeologue ventx1.1
which were used in [1]