XB-FEAT-479598: Difference between revisions

From XenWiki
Jump to navigation Jump to search
imported>Xenbase gene generator
No edit summary
 
imported>Kevin
No edit summary
 
Line 1: Line 1:
=ctnna1=  
=ctnna1=  
This is the community wiki page for the gene ''ctnna1'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
This is the community wiki page for the gene ''ctnna1'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
==Available Reagents==
===Morpholino Oligonucleotides===
Morpholinos have been designed for this gene with sequences <br />
ATGTTTCCTGTATTGAGAGTCATGC <br />
which were used in [http://www.xenbase.org/literature/article.do?method=display&articleId=45453]

Latest revision as of 12:21, 19 November 2012

ctnna1

This is the community wiki page for the gene ctnna1 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

Available Reagents

Morpholino Oligonucleotides

Morpholinos have been designed for this gene with sequences
ATGTTTCCTGTATTGAGAGTCATGC

which were used in [1]