XB-FEAT-481479: Difference between revisions
imported>Xenbase |
imported>Xenbase No edit summary |
||
Line 1: | Line 1: | ||
=csnk1e= | =tptep2-csnk1e= | ||
This is the community wiki page for the gene ''csnk1e'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase | This is the community wiki page for the gene ''tptep2-csnk1e'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase | ||
=nomenclature changes= | =nomenclature changes= | ||
Line 22: | Line 22: | ||
Morpholinos have been designed for this gene with sequences <br /> | Morpholinos have been designed for this gene with sequences <br /> | ||
TCCCCACTCTCAGCTCCATGTTTAC <br /> | TCCCCACTCTCAGCTCCATGTTTAC <br /> | ||
which were used in [http://www.xenbase.org/literature/article.do?method=display&articleId=7014] | which were used in [http://www.xenbase.org/literature/article.do?method=display&articleId=7014] | ||
=nomenclature changes= | |||
04.06.2018 | |||
Human symbol has changed for genepage ID: 481479 From csnk1e to TPTEP2-CSNK1E |
Revision as of 10:36, 30 April 2018
tptep2-csnk1e
This is the community wiki page for the gene tptep2-csnk1e please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
nomenclature changes
01/6/15 Human symbol has changed for genepage ID: 481479 From loc400927-csnk1e to CSNK1E
01/6/15 Changed symbol to csnk1e and added previous name as synonym
01/15/2015 Human symbol has changed for genepage ID: 481479 From csnk1e to LOC400927-CSNK1E
04/22/ 2016 Human name has changed for Entrez Gene: 1454. From casein kinase 1, epsilon to casein kinase 1 epsilon
06/19/2017 Human symbol has changed for genepage ID: 481479 From loc400927-csnk1e to CSNK1E
Available Reagents
Morpholino Oligonucleotides
Morpholinos have been designed for this gene with sequences
TCCCCACTCTCAGCTCCATGTTTAC
which were used in [1]
nomenclature changes
04.06.2018 Human symbol has changed for genepage ID: 481479 From csnk1e to TPTEP2-CSNK1E