XB-FEAT-481479: Difference between revisions
imported>Xenbase |
imported>Xenbase No edit summary |
||
Line 30: | Line 30: | ||
which were used in [http://www.xenbase.org/literature/article.do?method=display&articleId=7014] | which were used in [http://www.xenbase.org/literature/article.do?method=display&articleId=7014] | ||
Revision as of 08:48, 25 September 2018
tptep2-csnk1e
This is the community wiki page for the gene tptep2-csnk1e please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
nomenclature changes
01/6/15 Human symbol has changed for genepage ID: 481479 From loc400927-csnk1e to CSNK1E
01/6/15 Changed symbol to csnk1e and added previous name as synonym
01/15/2015 Human symbol has changed for genepage ID: 481479 From csnk1e to LOC400927-CSNK1E
04/22/ 2016 Human name has changed for Entrez Gene: 1454. From casein kinase 1, epsilon to casein kinase 1 epsilon
06/19/2017 Human symbol has changed for genepage ID: 481479 From loc400927-csnk1e to CSNK1E
05/08/2018
Human symbol has changed for genepage ID: 481479 From tptep2-csnk1e to CSNK1E
Available Reagents
Morpholino Oligonucleotides
Morpholinos have been designed for this gene with sequences
TCCCCACTCTCAGCTCCATGTTTAC
which were used in [1]