XB-FEAT-481479: Difference between revisions

From XenWiki
Jump to navigation Jump to search
imported>Xenbase
imported>Xenbase
Line 22: Line 22:


Human symbol has changed for genepage ID: 481479 From csnk1e to TPTEP2-CSNK1E
Human symbol has changed for genepage ID: 481479 From csnk1e to TPTEP2-CSNK1E
15June 2020
Human symbol has changed for genepage ID: 481479 From csnk1e to TPTEP2-CSNK1E readthrough


==Available Reagents==
==Available Reagents==

Revision as of 15:35, 7 July 2020

tptep2-csnk1e

This is the community wiki page for the gene tptep2-csnk1e please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

nomenclature changes

01/6/15 Human symbol has changed for genepage ID: 481479 From loc400927-csnk1e to CSNK1E

01/6/15 Changed symbol to csnk1e and added previous name as synonym

01/15/2015 Human symbol has changed for genepage ID: 481479 From csnk1e to LOC400927-CSNK1E

04/22/ 2016 Human name has changed for Entrez Gene: 1454. From casein kinase 1, epsilon to casein kinase 1 epsilon

06/19/2017 Human symbol has changed for genepage ID: 481479 From loc400927-csnk1e to CSNK1E


05/08/2018 The human symbol has changed for genepage ID: 481479 From tptep2-csnk1e to CSNK1E

09.23.2018

Human symbol has changed for genepage ID: 481479 From csnk1e to TPTEP2-CSNK1E

15June 2020 Human symbol has changed for genepage ID: 481479 From csnk1e to TPTEP2-CSNK1E readthrough


Available Reagents

Morpholino Oligonucleotides

Morpholinos have been designed for this gene with sequences
TCCCCACTCTCAGCTCCATGTTTAC


which were used in [1]