XB-FEAT-481479

From XenWiki
Revision as of 11:02, 13 November 2012 by imported>Kevin
Jump to navigation Jump to search

csnk1e

This is the community wiki page for the gene csnk1e please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

Available Reagents

Morpholino Oligonucleotides

Morpholinos have been designed for this gene with sequences
TCCCCACTCTCAGCTCCATGTTTAC

which were used in [1]

Retrieved from "https://wiki.xenbase.org/xenwiki/index.php?title=XB-FEAT-481479&oldid=21975"