XB-FEAT-484970: Difference between revisions
Jump to navigation
Jump to search
imported>Christina |
imported>Christina |
||
Line 7: | Line 7: | ||
"cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis)" | "cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis)" | ||
=Available Reagents= | |||
==Morpholino Oligonucleotides== | ==Morpholino Oligonucleotides== | ||
Revision as of 12:28, 6 August 2015
cer1
This is the community wiki page for the gene cer1 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
nomenclature changes
HGNC records the following previous names and synonyms for cer1: "cerberus 1 (Xenopus laevis) homolog (cysteine knot superfamily)", "cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis)"
Available Reagents
Morpholino Oligonucleotides
Morpholinos have been designed for this gene with sequences
CTAGACCCTGCAGTGTTTCTGAGCG
which were used in [1]