XB-FEAT-484970: Difference between revisions

From XenWiki
Jump to navigation Jump to search
imported>Kevin
No edit summary
imported>Christina
 
(3 intermediate revisions by the same user not shown)
Line 2: Line 2:
This is the community wiki page for the gene ''cer1'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
This is the community wiki page for the gene ''cer1'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase


==Available Reagents==
=nomenclature changes=
===Morpholino Oligonucleotides===
HGNC records the following previous names and synonyms for cer1:
"cerberus 1 (Xenopus laevis) homolog (cysteine knot superfamily)",
"cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis)"
 
=available reagents=
 
==Morpholino Oligonucleotides==


Morpholinos have been designed for this gene with sequences <br />
Morpholinos have been designed for this gene with sequences <br />

Latest revision as of 12:28, 6 August 2015

cer1

This is the community wiki page for the gene cer1 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

nomenclature changes

HGNC records the following previous names and synonyms for cer1: "cerberus 1 (Xenopus laevis) homolog (cysteine knot superfamily)", "cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis)"

available reagents

Morpholino Oligonucleotides

Morpholinos have been designed for this gene with sequences
CTAGACCCTGCAGTGTTTCTGAGCG

which were used in [1]