XB-FEAT-485326: Difference between revisions
Jump to navigation
Jump to search
imported>Xenbase gene generator No edit summary |
imported>Kevin No edit summary |
||
Line 1: | Line 1: | ||
=prox1= | =prox1= | ||
This is the community wiki page for the gene ''prox1'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase | This is the community wiki page for the gene ''prox1'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase | ||
==Available Reagents== | |||
===Morpholino Oligonucleotides=== | |||
Morpholinos have been designed for this gene with sequences <br /> | |||
CAGGCATCACTGGACTGTTATTGTG (translation blocking) <br /> | |||
AGCCAGGTTACTTACTCAGGGAAAG (splice blocking) | |||
which were used in [http://www.xenbase.org/literature/article.do?method=display&articleId=1468] |
Latest revision as of 13:28, 20 November 2012
prox1
This is the community wiki page for the gene prox1 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
Available Reagents
Morpholino Oligonucleotides
Morpholinos have been designed for this gene with sequences
CAGGCATCACTGGACTGTTATTGTG (translation blocking)
AGCCAGGTTACTTACTCAGGGAAAG (splice blocking)
which were used in [1]