XB-FEAT-486360

From XenWiki
Revision as of 08:04, 6 December 2012 by imported>Kevin
Jump to navigation Jump to search

ruvbl1

This is the community wiki page for the gene ruvbl1 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase


Available Reagents

Morpholino Oligonucleotides

Morpholinos have been designed for this gene with sequences
CATGAAAATCGAGGAGGTGAAGAGC

which were used in [1]