XB-FEAT-486800: Difference between revisions

From XenWiki
Jump to navigation Jump to search
imported>Kevin
No edit summary
imported>Kevin
No edit summary
Line 2: Line 2:
This is the community wiki page for the gene ''pax2'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
This is the community wiki page for the gene ''pax2'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase


==Available Reagents==
===Morpholino Oligonucleotides===
Morpholinos have been designed for this gene with sequences <br />
Morpholinos have been designed for this gene with sequences <br />
TGCAGTGCATATCCATGGGGAGGCA <br />
TGCAGTGCATATCCATGGGGAGGCA <br />

Revision as of 13:43, 12 November 2012

pax2

This is the community wiki page for the gene pax2 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

Available Reagents

Morpholino Oligonucleotides

Morpholinos have been designed for this gene with sequences
TGCAGTGCATATCCATGGGGAGGCA
GGTCTGCCTTGCAGTGCATATCCAT

which were used in [1]