XB-FEAT-491845
Revision as of 11:07, 19 November 2012 by imported>Kevin
chek1
This is the community wiki page for the gene chek1 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
Available Reagents
Morpholino Oligonucleotides
Morpholinos have been designed for this gene with sequences
TTCAACAAACGGAACTGCCATTTTG
which were used in [1]