XB-FEAT-481479

From XenWiki
Revision as of 11:42, 9 March 2015 by imported>Christina (→‎csnk1e)
Jump to navigation Jump to search
The printable version is no longer supported and may have rendering errors. Please update your browser bookmarks and please use the default browser print function instead.

csnk1e

This is the community wiki page for the gene csnk1e please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

nomenclature changes

01/6/15 Human symbol has changed for genepage ID: 481479 From loc400927-csnk1e to CSNK1E

01/6/15 Changed symbol to csnk1e and added previous name as synonym

01/15/2015 Human symbol has changed for genepage ID: 481479 From csnk1e to LOC400927-CSNK1E


Available Reagents

Morpholino Oligonucleotides

Morpholinos have been designed for this gene with sequences
TCCCCACTCTCAGCTCCATGTTTAC

which were used in [1]