XB-FEAT-5719326: Difference between revisions
Jump to navigation
Jump to search
imported>Kevin No edit summary |
imported>Xenbase (→h2ac21) |
||
Line 1: | Line 1: | ||
= | =h2ac21= | ||
This is the community wiki page for the gene '' | This is the community wiki page for the gene ''h2ac21'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase | ||
=nomenclature changes= | |||
08.23.2019 | |||
Human name has changed for Entrez Gene: 317772. From histone cluster 2 H2A family member b to H2A clustered histone 21 | |||
Human symbol has changed for genepage ID: 5719326 From hist2h2ab to h2ac21 | |||
Human symbol has changed for Entrez Gene: 317772. From HIST2H2AB to H2AC21 | |||
==Available Reagents== | ==Available Reagents== |
Revision as of 09:19, 26 August 2019
h2ac21
This is the community wiki page for the gene h2ac21 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
nomenclature changes
08.23.2019
Human name has changed for Entrez Gene: 317772. From histone cluster 2 H2A family member b to H2A clustered histone 21
Human symbol has changed for genepage ID: 5719326 From hist2h2ab to h2ac21
Human symbol has changed for Entrez Gene: 317772. From HIST2H2AB to H2AC21
Available Reagents
Morpholino Oligonucleotides
Morpholinos have been designed for this gene with sequences
TGACGGCTTTTCCTCTGCCCGACAT
which were used in [1]
This sequence is shared by gene symbol H2AFX and may therefore be cross-reactive.