XB-FEAT-5719326

From XenWiki
Revision as of 12:05, 19 November 2012 by imported>Kevin
Jump to navigation Jump to search

hist2h2ab

This is the community wiki page for the gene hist2h2ab please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

Available Reagents

Morpholino Oligonucleotides

Morpholinos have been designed for this gene with sequences
TGACGGCTTTTCCTCTGCCCGACAT

which were used in [1]

This sequence is shared by gene symbol H2AFX and may therefore be cross-reactive.